183 results 1-20

The Penguin Dictionary of Statistics

David Nelson (Author)

The Penguin Dictionary of Statistics is an accessible, comprehensive and up-to-date guide to the subject. This new reference book is ideal for students at school and university, and will be invaluable to students of disciplines such as economics, psychology and medicine who regularly use statistical methods, as well as those in the business community who want to understand the terminology.

The Fellowship

John Gribbin (Author)

From the bestselling author of Science: A History comes the enthralling story of a revolution that shook the world. Seventeenth-century England was racked by civil war, plague and fire; a world ruled by superstition and ignorance. A series of meetings of 'natural philosophers' in Oxford and London saw the beginning of a new method of thinking based on proof and experiment. John Gribbin's gripping, colourful account of this unparalleled time of discovery explores the impact of the Royal Society, culminating with Isaac Newton's revolutionary description of the universe and Edmund Halley's prediction of the return of a comet in 1759. This compelling book shows the triumph not as the work of one isolated genius, but of a Fellowship.

The New Penguin Dictionary of Science

Mike Clugston (Author)

This highly successful reference book is an indispensable tool for students and professionals. Revised and updated for its second edition, THE NEW PENGUIN DICTIONARY OF SCIENCE covers terms used in a wide range of topics, including molecular biology, biochemistry, astronomy and computing. The 7000 definitions are supported by illustrations and diagrams, making this the most accessible and comprehensive dictionary of science available.

The Penguin Dictionary of Human Biology

Michael Thain (Author)

Human biology is an essential area of study for medical, nursing and pharmacology students. Texts relating to this vital area have long been overlooked due to the dominance of biology as the 'umbrella' discipline, however, there is now an undeniable need for more specific and focused resources. The Penguin Dictionary of Human Biology brings together decades of knowledge acquired by author Michael Thain. Each entry is carefully researched and articulated and the extensive illustrations and diagrams help to explain even the most complex concepts.

The Anatomy of Violence

Adrian Raine (Author)

Are some criminals born, not made? What causes violence and how can we treat it? An Anatomy of Violence introduces readers to new ways of looking at these age-old questions. Drawing on the latest scientific research, Adrian Raine explains what it reveals about the brains of murderers, psychopaths and serial killers. Anti-social behaviour is complex, he argues, and based on the interaction between genetics and the biological and social environment in which a person is raised. But the latest statistical evidence between certain types of biological and early behavioural warning signs is also very strong. These are among the thorny issues we can no longer ignore and this book is an important milestone in our growing understanding of criminal behaviour.

The Signal and the Noise

Nate Silver (Author)

Every time we choose a route to work, decide whether to go on a second date, or set aside money for a rainy day, we are making a prediction about the future. Yet from the financial crisis to ecological disasters, we routinely fail to foresee hugely significant events, often at great cost to society.

In The Signal and the Noise, the New York Times political forecaster Nate Silver, who accurately predicted the results of every single state in the 2012 US election, reveals how we can all develop better foresight in an uncertain world. From the stock market to the poker table, from earthquakes to the economy, he takes us on an enthralling insider's tour of the high-stakes world of forecasting, showing how we can use information in a smarter way amid a noise of data - and make better predictions in our own lives.

Creation

Adam Rutherford (Author)

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

High Price

Carl Hart (Author)

High Price by Carl Hart is a groundbreaking work on neuroscience and addiction

As a youth, Carl Hart didn't see the value of school, studying just enough to keep him on the basketball team. At the same time, he was immersed in street life, dealing drugs and committing petty larceny. Today, he is a cutting-edge neuroscientist whose landmark, controversial research is redefining our understanding of addiction.

In this provocative and eye-opening memoir, he recalls his journey of self-discovery, how he escaped a life of crime and drugs and avoided becoming one of the crack addicts he now studies. Interweaving past and present, Hart goes beyond the hype as he examines the relationship between drugs and pleasure, choice, and motivation, both in the brain and in society. His findings shed new light on common ideas about race, poverty, and drugs and explain why current policies are failing. But while Hart escaped the ghetto, he has not turned his back on it. Determined to make a difference, he tirelessly applies his science to help save real lives. But balancing his former street life with his achievements today has not been easy-a struggle he reflects on publicly for the first time.

Homocide (the inspiration for The Wire) meets Oliver Sacks' The Man Who Mistook His Wife for A Hat, this book applies neuroscience to crime, addiction and the most urgent and destructive issues of our times.

Carl Hart is an Associate Professor in the Departments of Psychology and Psychiatry at Columbia University. He is also a Research Scientist in the Division of Substance Abuse at the New York State Psychiatric Institute. He and his work are featured in Eugene Jarecki's acclaimed documentary The House I Live In. The film examines the war on drugs and highlights some of the research that Hart includes in High Price. He lives in New York City.

Classical Mechanics

George Hrabovsky (Author)

This is the ultimate master class in modern physics. World-class physicist and father of string theory Leonard Susskind and citizen-scientist George Hrabovsky combine forces in a primer that teaches the skills you need to do physics yourself. Combining crystal-clear explanations of the laws of the universe with basic exercises (including essential equations and maths), the authors cover the minimum that readers should master. They introduce the key concepts of modern physics, from classical mechanics to general relativity to quantum theory, and provide a practical toolkit that you won't find in any other popular science book.

Our Mathematical Universe

Max Tegmark (Author)

In Our Mathematical Universe, Max Tegmark, one of the most original physicists at work today, leads us on an astonishing journey to explore the mysteries uncovered by cosmology and to discover the nature of reality

Part-history of the cosmos, part-intellectual adventure, Our Mathematical Universe travels from the Big Bang to the distant future via parallel worlds, across every possible scale - from the sub-atomic to the intergalactic - showing how mathematics provides the answers to our questions about the world. Where do we come from? What makes the universe the way it is? In essence, why are we here? With dazzling clarity, Max Tegmark ponders these deep mysteries and allows us to grasp the most cutting-edge and mind-boggling theories of physics. What he proposes is an elegant and fascinating idea: that our physical world not only is described by mathematics, but that it is mathematics.

'Our Mathematical Universe is nothing if not impressive. Brilliantly argued and beautifully written, it is never less than thought-provoking about the greatest mysteries of our existence' - New York Times

'An amazing ride through the rich landscape of contemporary cosmology... Physics could do with more characters like Tegmark... an imaginative intellect and a charismatic presence' - Clive Cookson, Financial Times

Max Tegmark is author or co-author of more than 200 technical papers, twelve of which have been cited more than 500 times. He has featured in dozens of science documentaries, and his work with the SDSS collaboration on galaxy clustering shared the first prize in Science magazine's "Breakthrough of the Year: 2003". He holds a Ph.D from the University of California, Berkeley, and is a physics professor at MIT.

The Origin of Species by Means of Natural Selection

Charles Darwin (Author) , J. Burrow (Edited by)

With his revolutionary work The Origin of Species Charles Darwin overthrew contemporary beliefs about Divine Providence and the beginnings of life on earth. Written for the general public of the 1850s, it is a rigorously documented but highly readable account of the scientific theory that now lies at the root of our present attitude to the universe. Challenging notions such as the fixity of species with the idea of natural selection, and setting forth the results of pioneering work on the ecology of animals and plants, it made a lasting contribution to philosophical and scientific thought.

Penguin Dictionary of Physics

Valerie Illingworth (Author) , J P Cullerne (Revised by)

The Penguin Dictionary of Physics provides clear and concise definitions for every area of physics - from optics and acoustics to mechanics and electronics, via quantum theory and relativity. The ideal reference guide to this fast-evolving subject, it will prove invaluable to students and teachers, scientists and doctors, and technicians and technologists. The dictionary provides definitions of some 4,600 terms and concepts, with numerous explanatory diagrams and an appendix of scientific tables and symbols.

The Filter Bubble

Eli Pariser (Author)

Imagine a world where all the news you see is defined by your salary, where you live, and who your friends are. Imagine a world where you never discover new ideas. And where you can't have secrets.

Welcome to 2011.

Google and Facebook are already feeding you what they think you want to see. Advertisers are following your every click. Your computer monitor is becoming a one-way mirror, reflecting your interests and reinforcing your prejudices.

The internet is no longer a free, independent space. It is commercially controlled and ever more personalised. The Filter Bubble reveals how this hidden web is starting to control our lives - and shows what we can do about it.

The Brain That Changes Itself

Norman Doidge (Author)

Meet the ninety year old doctor, who, with the aid of a few simple exercises, is still practising medicine. His is just one of the incredible stories brain expert Norman Doidge tells as he reveals our brain's remarkable ability to repair itself through the power of positive thought.

In The Brain That Changes Itself Doidge introduces us to the fascinating stories at the cutting edge of the brain science and the emerging discipline of 'neuroplasticity' . We meet the stroke victim who unable to feed or dress himself learned to move and talk again, the woman with a rare brain condition that left her feeling as though she was perpetually falling but who through a series of exercises rewired her brain to overcome this and the maverick scientists over turning centuries of assumptions about the brain and it's capacity for renewal. Doidge shows how their incredible work is helping the blind to see, the deaf to hear and causing Nobel laureates to rethink our model of the brain.

This remarkable book will leave you with a sense of wonder at the capabilities of the human brain and the power to change which lies within all of us.

Lewis Carroll in Numberland

Robin Wilson (Author)

Lewis Carroll's books have delighted children and adults for generations, but behind their exuberant fantasy and delightful nonsense was the mind of a brilliant mathematician.

Now his forgotten achievements in the world of numbers are brought to light by acclaimed author and mathematician Robin Wilson. Here he explores the curious imagination of a man whose pioneering work at Oxford University included investigations into voting patterns and tennis seeding, who dreamt up numerical conundrums in bed at night and who filled his writings with problems, paradoxes, puzzles and teasing games of logic.

Taking us into a world of mock turtles and maps, gryphons and gravity, Lewis Carroll in Numberland reveals the singular mind of a genius.

Time: A User's Guide

Stefan Klein (Author)

Why are there morning people and night people? How come time flies when you’re having fun and three minutes can sometimes seem an eternity? Would time exist if we didn’t measure it – and why is there never enough of it?

Our modern lives are ruled by minutes and hours. We race from one thing to the next, all of us believing on some level that a mysterious cosmic force called ‘time’ is ticking on. And it’s always in short supply.

But is the time we live really like that? Could there in fact be another, alternative version, entwined with the official one? Here Stefan Klein explores the hidden dimensions of time, looking at everything from when the present becomes the past to the tribe that see the future backwards, from when sex is best to why the years seem to speed by as we age. And he reveals how we can learn to live in harmony with the secret clock within us, altering our perceptions to transform our lives.

To be enjoyed in the morning or the evening (depending on your body clock), this book will make you think the next time you check your watch – and maybe even slow down a little.

The Trouble with Physics

Lee Smolin (Author)

The Trouble with Physics is a groundbreaking account of the state of modern physics: of how we got from Einstein and Relativity through quantum mechanics to the strange and bizarre predictions of string theory, full of unseen dimensions and multiple universes.

Lee Smolin not only provides a brilliant layman’s overview of current research as we attempt to build a ‘theory of everything’, but also questions many of the assumptions that lie behind string theory. In doing so, he describes some of the daring, outlandish ideas that will propel research in years to come.

The Universe

John Gribbin (Author)

John Gribbin's The Universe: A Biography explores the story of our cosmos, from the mystery of its origins to how scientists think it might end.

  • How did the universe grow from a tiny fireball to its present size?
  • Where did life on earth come from?
  • How do planets form?
  • How will the universe end?
  • And how do we even know all this anyway?

John Gribbin, one of Britain's most popular writers about science and the people who made it happen, has decided to create a biography of the greatest subject of all: the universe itself, from beginning to end (and beyond).

From the Big Bang 14 billion years ago, the formation of stars and galaxies and the first stirrings of life, to the latest thinking on dark matter and a theory of everything - and beyond to the future possibility of a Big Crunch or a Big Rip - this is the life history of the entire world around us.

'If you really want to know about the greatest story there is, then this is the book to read'
  Independent on Sunday

'As clear an account of current thinking on the subject as we are likely to get'
  Daily Telegraph

'One of Britain's best and most prolific science writers'
  Sunday Telegraph

'The master of popular science writing'
  Sunday Times

John Gribbin is one of today's greatest writers of popular science and the author of bestselling books, including In Search of Schrödinger's Cat, Stardust, Science: A History and In Search of the Multiverse. Gribbin trained as an astrophysicist at Cambridge University and is currently Visiting Fellow in Astronomy at the University of Sussex.

Qed

Richard P Feynman (Author)

In QED: The Strange Theory of Light and Matter Richard P. Feynman explains, in his lucid and witty style, the revolutionary scientific theory that won him the Nobel Prize.

Quantum electrodynamics - or QED for short - is the theory that explains how light and electrons interact, and in doing so illuminates the deepest and most complex mysteries of the world around us.

Thanks to Richard Feynman and his colleagues, who won the Nobel Prize for their groundbreaking work in this area, it is also one of the rare parts of physics that is known for sure - a theory that has stood the test of time. In these entertaining lectures Feynman uses clear everyday examples to provide the definitive introduction to QED.

'The perfect example of scientific genius'
  Independent

'If you don't believe Nature is absurd, let chatty Professor Feynman convince you in his series of exceedingly reader-friendly lectures ... Full of witty one-liners, with its learning lightly worn, it's a book to enlighten'
  Mail on Sunday

'Does a marvelous job of explaining one of twentieth-century physics' few unqualified triumphs'
  The New York Times

Richard P. Feynman (1918-1988) was one of this century's most brilliant theoretical physicists and original thinkers. Feynman's other books, also available in Penguin, include QED, Six Easy Pieces, Six Not-so-Easy Pieces, Don't You Have Time to Think, The Pleasure of Finding Things Out, What Do You Care What Other People Think? and The Meaning of it All.

Don't You Have Time to Think?

Richard P Feynman (Author)

Don't You Have Time to Think? collects the witty, eccentric and moving letters letters of Nobel Prize-winning physicist Richard P. Feynman.

Richard Feynman was no ordinary genius. Brilliant, free-spirited and irreverent, he upset those in authority, gave captivating lectures, wrote equations on napkins in strip joints and touched countless lives everywhere. He also wrote hundreds of letters to friends, family, critics, colleagues and devoted fans around the world.

Now these letters have been brought together for the first time. From down-to-earth advice to eager students to discussions of time travel and the atom bomb, and from blunt rebuttals to journalists to poignant exchanges with his first wife as she lay dying, they will introduce you to a unique person whose wisdom and lust for life inspired all those who came into his orbit.

'Nobel-winning physicist, expert bongo-player, safe-cracker and all-round genius, Feynman was, as this wonderful and inspiring collection records, also a champion letter-writer ... Witty, deadpan, warm ... some are unbearably poignant'
  Guardian

'Plain-speaking ... touching'
  Daily Telegraph

'He sparked excitement not just about science but also about the power of creativity, passion, curiosity'
  The New York Times

Richard P. Feynman (1918-1988) was one of this century's most brilliant theoretical physicists and original thinkers. Feynman's other books, also available in Penguin, include QED, Six Easy Pieces, Six Not-so-Easy Pieces, Don't You Have Time to Think, The Pleasure of Finding Things Out, What Do You Care What Other People Think? and The Meaning of it All.

1-20 of 183 results

Show 20 per page